Skip to main navigation Skip to search Skip to main content

Exploring the binding of calothrixin A to the G-quadruplex from the c-myc oncogene promotor

  • Elisabeth A. Owen
  • , Max A. Keniry

    Research output: Contribution to journalArticlepeer-review

    8 Citations (Scopus)

    Abstract

    Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

    Original languageEnglish
    Pages (from-to)1544-1549
    Number of pages6
    JournalAustralian Journal of Chemistry
    Volume62
    Issue number11
    DOIs
    Publication statusPublished - 2009

    Fingerprint

    Dive into the research topics of 'Exploring the binding of calothrixin A to the G-quadruplex from the c-myc oncogene promotor'. Together they form a unique fingerprint.

    Cite this